Prev. | 

RIKEN DNA Bank Human Resource - ANAPC15

Gene ID NCBI Gene 25906 |  KEGG hsa:25906
Gene Symbol ANAPC15
Protein Name anaphase promoting complex subunit 15
Synonyms APC15|C11orf51|HSPC020
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084139 IRAL010F19 pOTB7 BC005156 NM_014042 Full
HGY086584 IRAL016H16 pDNR-LIB BC005393 NM_014042 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098015 M01C045A15 pDONR221 MGC12-A08 BC005156 NM_014042  
HGE098063 M01C045C15 pDONR221 MGC12-A08 BC005156 NM_014042  
HGE098111 M01C045E15 pDONR221 MGC12-A08 BC005156 NM_014042  
HGE098159 M01C045G15 pDONR221 MGC12-A08 BC005156 NM_014042  
HGE098207 M01C045I15 pDONR221 MGC12-A08 BC005156 NM_014042  
HGE098255 M01C045K15 pDONR221 MGC12-A08 BC005156 NM_014042  
HGE098303 M01C045M15 pDONR221 MGC12-A08 BC005156 NM_014042  
HGE098351 M01C045O15 pDONR221 MGC12-A08 BC005156 NM_014042  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046577 ARe16H09 pKA1U5 NM_014042.2  
GGAGCGGGGAAAACAAAAGGAGACGAAGGACGCATGCGTTTGGTGAGTCCCGGATTCTGG
HKR166857 ARi17C09 pGCAP10 NM_014042.2  
GGAGACGAAGGACGCATGCGTTTGGTGAGTCCCGGATTCTGGTGGGTTCTTCCGCTCAGG
HKR168476 ARi21D04 pGCAP10 NM_014042.2  
GGAGACGAAGGACGCATGCGTTTGGTGAGTCCCGGATTCTNGGTGGGTTCTTCCGCTCAG
HKR326476 RBb16D04 pKA1U5 NM_014042.2  
GGGGAGCGGGGAAAACAAAAGGAGACGAAGGACGCATGCGTTTGGTGAGTCCCGGATTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl