Prev. | 

RIKEN DNA Bank Human Resource - CCDC28A

Gene ID NCBI Gene 25901 |  KEGG hsa:25901
Gene Symbol CCDC28A
Protein Name coiled-coil domain containing 28A
Synonyms C6orf80|CCRL1AP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080863 IRAL002C15 pOTB7 BC000758 NM_015439 Partial/var
HGY083907 IRAL009M19 pOTB7 BC004464 NM_015439 Partial/var
HGY103889 IRAL059M01 pOTB7 BC080566 NM_015439 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR165378 ARi13H10 pGCAP10 NM_015439.2  
GAGCGGGTCCCGGGATGTGACCGGGGCTCTGCTTGTGGCTGCGGCGGTGGCTTCTGAGGC
HKR203564 ARiS008P04 pGCAP10 NM_015439.2  
GGTCACTTCCGTAAACAAACGGAGCTGCGGAGGAGCGGGTCCCGGGATGTGACCGGGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl