Prev. | 

RIKEN DNA Bank Human Resource - SUMF2

Gene ID NCBI Gene 25870 |  KEGG hsa:25870
Gene Symbol SUMF2
Protein Name sulfatase modifying factor 2
Synonyms pFGE
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082411 IRAL006A11 pOTB7 BC000224 NM_015411 Partial
HGY087410 IRAL018I18 pOTB7 BC006159 NM_015411 Partial
HGY093399 IRAL033I07 pOTB7 BC015600 NM_015411 Partial/var
HGY103950 IRAL059O14 pOTB7 BC084539 NM_015411 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE046403 W01A116A03 pENTR-TOPO flj0027f17 AK075477 NM_015411  
HGE046405 W01A116A05 pENTR-TOPO flj0027f17 AK075477 NM_015411  
HGE046409 W01A116A09 pENTR-TOPO flj0027f17 AK075477 NM_015411  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168173 ARi20H05 pGCAP10 NM_015411.2  
GAGTCCTGATGGCCCGGCATGGGTTACCGCTGCTGCCCCTGCTGTCGCTCCTGGTCGGCG
HKR177350 ARi43G06 pGCAP10 NM_015411.2  
GCTGATGGCCCGGCATGGGTTACCGCTGCTGCCCCTGCTGTCGCTCCTGGTCGGCGCGTG
HKR277687 ARiS194D15 pGCAP10 NM_015411.2  
GATGCNCNNNGGGGCCGTGGGTGTACGCGGCGCAGCGCGGCAGTCCTGATGGCCCGGCAT
HKR433354 RBdS083G10 pGCAP10 NM_015411.2  
GCCTGATGGCCCGGCATGGGTTACCGCTGCTGCCCCTGCTGTCGCTCCTGGTCGGCGCGT
HKR461820 RBdS154J04 pGCAP10 NM_015411.2  
GAGTCCTGATGGCCCGGCATGGGTTACCGCTGCTGCCCCTGCTGTCGCTCCTGGTCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl