Prev. |  KEGG KO K11803 > 

RIKEN DNA Bank Human Resource - DCAF12

Gene ID NCBI Gene 25853 |  KEGG hsa:25853
Gene Symbol DCAF12
Protein Name DDB1 and CUL4 associated factor 12
Synonyms CT102|KIAA1892|TCC52|WDR40A
Ortholog resource in our bank

  DCAF12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056484 IRAK141D12 pCMV-SPORT6 BC063823 NM_015397 Full/var
HGY081441 IRAL003K01 pOTB7 BC008893 NM_015397 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR181329 ARi53F09 pGCAP10 NM_015397.2  
GCTCGCTTCCCCTTCCCTTTCCCGGCTCAAGTCCTTCCTCTCTCTTTCCTTTCTTTCCGC
HKR370412 RBd26A12 pGCAP10 NM_015397.2  
GGTCCTTGCAGGCTCTGCCGTCGGAAAGCCGCTCATTCTCGCTTCCCCTTCCCTTTCCCG
HKR398403 RBd96A03 pGCAP10 NM_015397.2  
CGGCCGGCCGATGGCTCATTCTCGCTTCCCCTTCCCTTTCCCGGCTCAAGTCCTTCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl