Prev. |  KEGG KO K17988 > 

RIKEN DNA Bank Human Resource - TECPR1

Gene ID NCBI Gene 25851 |  KEGG hsa:25851
Gene Symbol TECPR1
Protein Name tectonin beta-propeller repeat containing 1
Synonyms -
Ortholog resource in our bank

  TECPR1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046120 IRAK115E24 pCMV-SPORT6 BC053591 NM_015395
HGY082869 IRAL007C21 pOTB7 BC012529 NM_015395 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095608 M01C039A08 pDONR221 MGC09-B04 BC053591 NM_015395  
HGE095656 M01C039C08 pDONR221 MGC09-B04 BC053591 NM_015395  
HGE095704 M01C039E08 pDONR221 MGC09-B04 BC053591 NM_015395  
HGE095752 M01C039G08 pDONR221 MGC09-B04 BC053591 NM_015395  
HGE095800 M01C039I08 pDONR221 MGC09-B04 BC053591 NM_015395  
HGE095848 M01C039K08 pDONR221 MGC09-B04 BC053591 NM_015395  
HGE095896 M01C039M08 pDONR221 MGC09-B04 BC053591 NM_015395  
HGE095944 M01C039O08 pDONR221 MGC09-B04 BC053591 NM_015395  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043654 ARe09C06 pKA1U5 NM_015395.1  
GCCCCGGGAGGGCCGGTCCGCTCCTCCCGGACGCCGAGGACCTACCACCGCGACTTCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl