Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANAPC13

Gene ID (NCBI) 25847
Gene Symbol ANAPC13
Protein Name anaphase promoting complex subunit 13
Synonyms APC13|SWM1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12456)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086469 IRAL016C21 pDNR-LIB BC005398 NM_015391 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE082832 M01C007B08 pDONR221 FLJ01-D04 AK026550 NM_015391  
HGE082880 M01C007D08 pDONR221 FLJ01-D04 AK026550 NM_015391  
HGE082928 M01C007F08 pDONR221 FLJ01-D04 AK026550 NM_015391  
HGE082976 M01C007H08 pDONR221 FLJ01-D04 AK026550 NM_015391  
HGE083024 M01C007J08 pDONR221 FLJ01-D04 AK026550 NM_015391  
HGE083072 M01C007L08 pDONR221 FLJ01-D04 AK026550 NM_015391  
HGE083120 M01C007N08 pDONR221 FLJ01-D04 AK026550 NM_015391  
HGE083168 M01C007P08 pDONR221 FLJ01-D04 AK026550 NM_015391  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR016569 ARa41H01 pKA1U5 NM_015391.3  
GAGGAGCAAGCGTCTGCCGCGGTGGCCGGGTGCCGATTTGACAAGATCAAAGCTGCAGGA
HKR393231 RBd83B07 pGCAP10 NM_015391.3  
GAGGAGCAAGCGTCTGCCGCGGTGGCCGGGTGCCGATTTGACAAGATCAAAGCTGCAGGA
HKR416190 RBdS040H22 pGCAP10 NM_015391.3  
GGCAGGAGCAAGCGTCTGCCGCGGTGGCCGGGTGCCGATTTGACAAGATCAAAGCTGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl