Prev. |  KEGG KO K11187 > 

RIKEN DNA Bank Human Resource - PRDX5

Gene ID NCBI Gene 25824 |  KEGG hsa:25824
Gene Symbol PRDX5
Protein Name peroxiredoxin 5
Synonyms ACR1|AOEB166|B166|HEL-S-55|PLP|PMP20|PRDX6|PRXV|SBBI10|prx-V
Ortholog resources KEGG ortholog (KEGG orthology K11187) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040901 ARe02E05 pKA1U5 NM_012094.3  
GGGGGCGGGTATGGGACTAGCTGGCGTGTGCGCCCTGAGACGCTCAGCGGGCTATATACT
HKR056052 ARe40C04 pKA1U5 NM_012094.3  
GGGAGTGGAAGTGGCCGTGGGGCGGGTATGGGACTAGCTGGCGTGTGCGCCCTGAGACGC
HKR062153 ARe55G09 pKA1U5 NM_012094.3  
GGCCTGCTGCGGTGGCACCANCCAGNAGGCGGNCCTTTAAGTGGCCGTGGGGCGGGTATG
HKR062834 ARe57B10 pKA1U5 NM_012094.3  
GGCTGCGGTGGCACCAGCCAGGAGGCGGAGTGGAAGTGGCCGTGGGGCGGGTATGGGACT
HKR065632 ARe64B08 pKA1U5 NM_012094.3  
GANNCAGNAGGCGGATNGGAAGTGGCCGTGGGGCGGGTATGGGACTAGCTGGCGTGTGCG
HKR070898 ARe77E02 pKA1U5 NM_012094.3  
GACCAGCCAGGAGGCGGAGTGGAAGTGGCCGTGGGNCGGGTATGGGACTAGCTGGCGTGT
HKR077724 ARe94F04 pKA1U5 NM_012094.3  
GGGAGTGGAAGTGGCCGTGGGGCGGGTATGGGACTAGCTGGCGTGTGCGCCCTGAGACGC
HKR080500 ARf01E04 pKA1U5 NM_012094.3  
GAGTCTGCGGCAGCGGCAGCAAGACGGTGCAGTGAAGGAGAGTGGGCGTCTGGCGGGGTC
HKR082431 ARf06B07 pKA1U5 NM_012094.3  
GGCTCAGCGGGCTATATACTCGTCGGTGGGGCCGGCGGATCAGTCTGCGGCAGCGGCAGC
HKR165701 ARi14E05 pGCAP10 NM_012094.3  
NNNTGGGGCGGTTCTGGGACTAGCTGGCGTGTGGCCCTGGTACGCTCTCGGGCTATATAC
HKR176579 ARi41H11 pGCAP10 NM_012094.3  
GGGAGGCGGCCCAGGCCCGCCTTCCGCAGGGTGTCGCCGCTGTGCCGCTAGCGGTGCCCC
HKR184925 ARi62F05 pGCAP10 NM_012094.3  
GAGGAGGCGGAGTGGAAGTGGCCGTGGGGCGGGTATGGGACTAGCTGGCGTGTGCGCCCT
HKR203282 ARiS008D10 pGCAP10 NM_012094.3  
CGGCCGGCCGATGGTGGGGCGGGTATGGGACTAGCTGGCGTGTGCGCCCTGAGACGCTCA
HKR203391 ARiS008H23 pGCAP10 NM_012094.3  
GGTCGCCGCTGTGCCGCTAGCGGTGCCCCGCCTGCTGCGGTGGCACCAGCCAGGAGGCGG
HKR205564 ARiS013P04 pGCAP10 NM_012094.3  
GACCAGCCAGGAGGCGGAGTGGAAGTGGCCGTGGGGCGGGTATGGGACTAGCTGGCGTGT
HKR247340 ARiS118F20 pGCAP10 NM_012094.3  
GGCCCCGCCTGCTGCGGTGGCACCAGCCAGGAGGCGGAGTGGAAGTGGCCGTGGGGCGGG
HKR260337 ARiS150O01 pGCAP10 NM_012094.3  
GAGGCGGCCCAGGCCCGCCTTCCNCANGGTGTCGCCGCTGTGCCGCTAGCGGTGCCCCGC
HKR322834 RBb07B10 pKA1U5 NM_012094.3  
GGGTCAGTCTGCGGCAGCGGCAGCAAGACGGTGCAGTGAAGGAGAGTGGGCGTCTGGCGG
HKR334076 RBb35D04 pGCAP1 NM_012094.3  
HKR343331 RBb58F11 pGCAP1 NM_012094.3  
GGTGGCCGTGGGGCGGGTATGGGACTAGCTGGCGTGTGCGCCCTGAGACGCTCAGCGGGC
HKR345307 RBb63E11 pGCAP1 NM_012094.3  
GGCAGTGGAGGCGGCCCAGGCCCGCCTTCCGCAGGGTGTCGCCGCTGTGCCGCTAGCGGT
HKR405286 RBdS013D14 pGCAP10 NM_012094.3  
GCTGCTGCGGTGGCACCANCCAGGAGGCGGAGTGGAAGTGGCCGTGGGGCGGGTATGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl