Prev. |  KEGG KO K09511 > 

RIKEN DNA Bank Human Resource - DNAJB5

Gene ID NCBI Gene 25822 |  KEGG hsa:25822
Gene Symbol DNAJB5
Protein Name DnaJ heat shock protein family (Hsp40) member B5
Synonyms Hsc40
Ortholog resource in our bank

  DNAJB5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091963 IRAL029P03 pOTB7 BC012115 NM_012266 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR441693 RBdS104D21 pGCAP10 NM_012266.4  
GGGGGGCGGGCTCCCGGTCCCGCTATCGGCGGCCGGCGGGCAGGCGACTCCTGTCCCGGG
HKR452858 RBdS132C10 pGCAP10 NM_012266.4  
GAGGCGACTCCTGTCCCGGGTGGAGGCGGCGGAGCCGGAGCCGGGGGAGGGGGCAGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl