Prev. |  KEGG KO K07277 > 

RIKEN DNA Bank Human Resource - SAMM50

Gene ID NCBI Gene 25813 |  KEGG hsa:25813
Gene Symbol SAMM50
Protein Name SAMM50 sorting and assembly machinery component
Synonyms CGI-51|OMP85|SAM50|TOB55|TRG-3|YNL026W
Ortholog resource in our bank

  SAMM50

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088018 IRAL020A18 pOTB7 BC007830 NM_015380 Full/var
HGY088448 IRAL021B24 pDNR-LIB BC015200 NM_015380 Full
HGY090821 IRAL027A21 pOTB7 BC011681 NM_015380

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007134 W01A017N22 pENTR-TOPO IRAL020A18 BC007830 NM_015380  
HGE007255 W01A018C07 pENTR-TOPO IRAL027A21 BC011681 NM_015380  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067723 ARe69F03 pKA1U5 NM_015380.3  
GGACCCGCCTTCTGCCCTCAGCAGCAGACGCTCTGTCCCGCCCGGGCAGCTCTGCGAGGC
HKR169280 ARi23D08 pGCAP10 NM_015380.3  
GCTCAGCAGCAGACGCTCTGTCCCGCCCGGGCAGCTCTGCGAGGCAGCGGCTGGAGAGGG
HKR331708 RBb29E12 pGCAP1 NM_015380.3  
GGGGAGTTGCCTTGACCTGCAGCTCCGCCACCGCGGACCCGCCTTCTGCCCTCAGCAGCA
HKR332053 RBb30C05 pGCAP1 NM_015380.3  
GGGGAGTTGCCTTGACCTGCAGCTCCGCCACCGCGGACCCGCCTTCTGCCCTCAGCAGCA
HKR379356 RBd48G12 pGCAP10 NM_015380.3  
GAGCAGCAGACGCTCTGTCCCGCCCGGGCAGCTCTGCGAGGCAGCGGCTGGAGAGGGAAC
HKR380179 RBd50H11 pGCAP10 NM_015380.3  
GGTCCCGCCCGGGCAGCTCTGCGAGGCAGCGGCTGGAGAGGGAACCATGGGGACTGTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl