Prev. |  KEGG KO K12623 > 

RIKEN DNA Bank Human Resource - LSM4

Gene ID NCBI Gene 25804 |  KEGG hsa:25804
Gene Symbol LSM4
Protein Name LSM4 homolog, U6 small nuclear RNA and mRNA degradation associated
Synonyms GRP|YER112W
Ortholog resource in our bank

  LSM4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080512 IRAL001E16 pOTB7 BC000387 NM_012321 Full
HGY084700 IRAL011M12 pOTB7 BC003652 NM_012321 Full
HGY084735 IRAL011N23 pOTB7 BC022198 NM_012321 Full
HGY095870 IRAL039L06 pOTB7 BC023665 NM_012321 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE031649 W01A079C01 pENTR-TOPO IRAL001E16 BC000387 NM_012321  
HGE031655 W01A079C07 pENTR-TOPO IRAL001E16 BC000387 NM_012321  
HGE031657 W01A079C09 pENTR-TOPO IRAL001E16 BC000387 NM_012321  
HGE031659 W01A079C11 pENTR-TOPO IRAL001E16 BC000387 NM_012321  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209315 ARiS023E19 pGCAP10 NM_012321.3  
TTGGGAGCGTGTGCAGCGGCGGCGGCGGAAGTGGCCGGCGAGCCCGGTCCCCGCCGGCAC
HKR219770 ARiS049H02 pGCAP10 NM_012321.3  
GAGCGTGTGCAGCGGCGGCGGCGGAAGTGGCCGGCGAGCCCGGTCCCCGCCGGCACCATG
HKR234257 ARiS085K17 pGCAP10 NM_012321.3  
AGCGTGTGCAGCGGCGGCGGCGGAAGTGGCCGGCGAGCCCGGTCCCCGCCGGCACCATGC
HKR323204 RBb08A04 pKA1U5 NM_012321.3  
GGCGGCGACGACCGCCGGGAGCGTGTGCAGCGGCGGCGGCGGAAGTGGCCGGCGAGCCCG
HKR334803 RBb37A03 pGCAP1 NM_012321.3  
GGCCGGGAGCGTGTGCAGCGGCGGCGGCGGAAGTGGCCGGCGAGCCCGGTCCCCGCCGGC
HKR379652 RBd49C04 pGCAP10 NM_012321.3  
GGGCGAGCCCGGTCCCCGCCGGCACCATGCTTCCCTTGTCACTGCTGAAGACGGCTCAGA
HKR381256 RBd53C08 pGCAP10 NM_012321.3  
GGCCGGGAGCGTGTGCAGCGGCGGCGGCGGAAGTGGCCGGCGNGCCCGGTCCCCGCCGGC
HKR393356 RBd83G12 pGCAP10 NM_012321.3  
TGGAGGGCCGGGAGCGTGTGCAGCGGCGGCGGCGGAAGTGGCCGGCGAGCCCGGTCCCCG
HKR420555 RBdS051G11 pGCAP10 NM_012321.3  
GAGTGGCGCGCGGCGCGGCGACGACCGCCGGGAGCGTGTGCAGCGGCGGCGGCGGAAGTG
HKR428114 RBdS070E18 pGCAP10 NM_012321.3  
GGAGCCCGGTCCCCGCCGGCACCATGCTTCCCTTGTCACTGCTGAAGACGGCTCAGAATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl