Prev. |  KEGG KO K10293 > 

RIKEN DNA Bank Human Resource - FBXO7

Gene ID NCBI Gene 25793 |  KEGG hsa:25793
Gene Symbol FBXO7
Protein Name F-box protein 7
Synonyms FBX|FBX07|FBX7|PARK15|PKPS
Ortholog resources KEGG ortholog (KEGG orthology K10293) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY089579 IRAL023P19 pOTB7 BC008361 NM_012179 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002611 W01A006I19 pENTR-TOPO IRAL023P19 BC008361 NM_012179  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR080546 ARf01G02 pKA1U5 NM_012179.3  
GCTTTAGGCCGCCTGCCCGCCTCCAGCTCTCGGGGTCGGCTCCAGGAGGCGCCCTCAGGA
HKR340855 RBb52C07 pGCAP1 NM_012179.3  
GGGGGTCGGCTCTAGGAAGGCGCCCTCAGGAAGAGGGGCGGGCGCTTCTATTCCAGAGAC
HKR369627 RBd24B03 pGCAP10 NM_012179.3  
GGAGGGGCGGGCGCTCTATTCCAGAGACCGAGTGGCAGGGCGGCCACTGTGGCGGGGCTC
HKR416066 RBdS040C18 pGCAP10 NM_012179.3  
GGGGCGCTCTATTCCAGAGACCGAGTGGCAGGGCGGCCACTGTGGCGGGGCTCTTTCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl