Prev. |  KEGG KO K12821 > 

RIKEN DNA Bank Human Resource - PRPF40B

Gene ID NCBI Gene 25766 |  KEGG hsa:25766
Gene Symbol PRPF40B
Protein Name pre-mRNA processing factor 40 homolog B
Synonyms HYPC
Ortholog resources KEGG ortholog (KEGG orthology K12821) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX017083 IRAK042L19 pCMV-SPORT6 BC031917 NM_001031698 Partial/var
HGX039432 IRAK098J16 pCMV-SPORT6 BC050398 NM_001031698 Partial/var
HGY100381 IRAL050P21 pOTB7 BC067364 NM_012272

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081207 M01C003A07 pDONR221 04-134-2_2-A04 BC067364 ENST00000261897  
HGE081255 M01C003C07 pDONR221 04-134-2_2-A04 BC067364 ENST00000261897  
HGE081303 M01C003E07 pDONR221 04-134-2_2-A04 BC067364 ENST00000261897  
HGE081351 M01C003G07 pDONR221 04-134-2_2-A04 BC067364 ENST00000261897  
HGE081399 M01C003I07 pDONR221 04-134-2_2-A04 BC067364 ENST00000261897  
HGE081447 M01C003K07 pDONR221 04-134-2_2-A04 BC067364 ENST00000261897  
HGE081495 M01C003M07 pDONR221 04-134-2_2-A04 BC067364 ENST00000261897  
HGE081543 M01C003O07 pDONR221 04-134-2_2-A04 BC067364 ENST00000261897  
HGE096006 M01C040A06 pDONR221 MGC09-F03 BC067364 ENST00000261897  
HGE096054 M01C040C06 pDONR221 MGC09-F03 BC067364 ENST00000261897  
HGE096102 M01C040E06 pDONR221 MGC09-F03 BC067364 ENST00000261897  
HGE096150 M01C040G06 pDONR221 MGC09-F03 BC067364 ENST00000261897  
HGE096198 M01C040I06 pDONR221 MGC09-F03 BC067364 ENST00000261897  
HGE096246 M01C040K06 pDONR221 MGC09-F03 BC067364 ENST00000261897  
HGE096294 M01C040M06 pDONR221 MGC09-F03 BC067364 ENST00000261897  
HGE096342 M01C040O06 pDONR221 MGC09-F03 BC067364 ENST00000261897  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044051 ARe10C03 pKA1U5 NM_012272.1  
GACCGGGCCGGTTGGGGCCCCGCTCGCCGGCGGGAGCCACCGGAGCCCCGGCCACGAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl