Prev. | 

RIKEN DNA Bank Human Resource - HYPK

Gene ID NCBI Gene 25764 |  KEGG hsa:25764
Gene Symbol HYPK
Protein Name huntingtin interacting protein K
Synonyms C15orf63|HSPC136
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082496 IRAL006D24 pOTB7 BC019262 NM_016400

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180836 ARi52B12 pGCAP10 NM_016400.2  
GGAGGTGGGGCTTATGCGGCGGCGTGGTGAAATAGATATGGCGACCGAGGGGGATGTGGA
HKR222128 ARiS055F08 pGCAP10 NM_016400.2  
GGTGGTGAAATAGATATGGCGACCGAGGGGGATGTGGAGCTGGAGTTGGAGACTGAGACC
HKR247414 ARiS118I22 pGCAP10 NM_016400.2  
GGTGGTGAAATAGATATGGCGACCGAGGGGGATGTGGAGCTGGAGTTGGAGACTGAGACC
HKR325625 RBb14B01 pKA1U5 NM_016400.2  
GGCGTGAGGTGGGGCTTATGCNGCGGCGTGGCTNAAATAGATATGGCGACCGAGGGGGAT
HKR346103 RBb65E07 pGCAP1 NM_016400.2  
GGTCAGTTGCCGGAAGTCGGCGTGAGGTGGGGCTTATGCGGCGGCGTGGTGAAATAGATA
HKR409002 RBdS022I10 pGCAP10 NM_016400.2  
NGGNGTGGTNANNNNNNNNTGGCTACCGAAGGGGATGTGGAGCTGGAGTTGAAGTCTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl