Prev. |  KEGG KO K15485 > 

RIKEN DNA Bank Human Resource - BCL2L13

Gene ID NCBI Gene 23786 |  KEGG hsa:23786
Gene Symbol BCL2L13
Protein Name BCL2 like 13
Synonyms BCL-RAMBO|Bcl2-L-13|MIL1
Ortholog resources KEGG ortholog (KEGG orthology K15485) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006369 IRAK015P09 pCMV-SPORT6 BC016037 NM_015367 Partial
HGY082367 IRAL005P07 pOTB7 BC007658 NM_015367 Full/var
HGY083677 IRAL009D05 pOTB7 BC003032 NM_015367 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE023657 W01A059C09 pENTR-TOPO IRAL005P07 BC007658 NM_015367  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR277960 ARiS194O24 pGCAP10 NM_015367.2  
GAACATGGCGGCGGCGGTAGATTANGNCCGCGGGTCGGANCACTCACCGCCGCTGGGGGA
HKR367307 RBd18E11 pGCAP10 NM_015367.2  
GACGCCGGGGTGACCTCACCCTCCAACATGGCGGCGGCGGTAGATTAGGGCCGCGGGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv

2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl