Prev. |  KEGG KO K09574 > 

RIKEN DNA Bank Human Resource - FKBP8

Gene ID NCBI Gene 23770 |  KEGG hsa:23770
Gene Symbol FKBP8
Protein Name FK506 binding protein 8
Synonyms FKBP38|FKBPr38
Ortholog resources KEGG ortholog (KEGG orthology K09574) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090729 IRAL026N17 pOTB7 BC009966 NM_012181 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055604 ARe39A04 pKA1U5 NM_012181.3  
GGGCCGAACCTGGTTCCCGAGGCGCGGCGGCCGCGGCTGGGGGCGGGGAGGGGGGCGCAG
HKR234815 ARiS087A15 pGCAP10 NM_012181.3  
GAACCTGGTTCCCGAGGCGCGGCGGCCGCGGCTGGGGGCGGGGAGGGGGGCGCAGGACNT
HKR238410 ARiS096A10 pGCAP10 NM_012181.3  
CGGCCGGCCGATGCGGCGGCCGCGGCTGGGGGCGGGGAGGGGGGCGCAGNANNNNTTTTN
HKR243708 ARiS109E12 pGCAP10 NM_012181.3  
GAAGTGGGGGTCCCGGAGCCAGAGGGCCAATTCCTGTCCCCCCAGCAGCATGGCATCGTG
HKR366550 RBd16G06 pGCAP10 NM_012181.3  
GGCCGAACCTGGTTCCCGAGGCGCGGCGGCCGCGGCTGGGGGCGGGGAGGGGGGCGCAGG
HKR387376 RBd68H08 pGCAP10 NM_012181.3  
TGGNTTCCCGAGGCGCGGCGGCCGCGGCTGGGGGCGGGGAGGGGGGCGCAGGACCCCAAG
HKR420734 RBdS051N22 pGCAP10 NM_012181.3  
GCCCGAGGCGCGGCGGCCGCGGCTGGGGGCGGGGAGGGGGGCGCAGGACCCCAAGTGGGG
HKR452842 RBdS132B18 pGCAP10 NM_012181.3  
TGGGGCCGAACCTGGTTCCCGAGGCGCGGCGGCCGCGGCTGGGGGCGGGGAGGGGGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl