Prev. |  KEGG KO K20462 > 

RIKEN DNA Bank Human Resource - OSBP2

Gene ID NCBI Gene 23762 |  KEGG hsa:23762
Gene Symbol OSBP2
Protein Name oxysterol binding protein 2
Synonyms HLM|ORP-4|ORP4|OSBPL1|OSBPL4
Ortholog resource in our bank

  OSBP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041449 W01A103K09 pENTR-TOPO flj0007b05 AK093196 NM_030758 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR442226 RBdS105J10 pGCAP10 NM_030758.3 done
GGCCACACGGCGGCGCCGGGCATGAGCGCTTCCACGTCCGGCTCCGGGCCGGAGCCCAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl