Prev. |  KEGG KO K10598 > 

RIKEN DNA Bank Human Resource - PPIL2

Gene ID NCBI Gene 23759 |  KEGG hsa:23759
Gene Symbol PPIL2
Protein Name peptidylprolyl isomerase like 2
Synonyms CYC4|CYP60|Cyp-60|UBOX7|hCyP-60
Ortholog resource in our bank

  PPIL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018533 IRAK046F13 pBluescriptR BC028385 NM_148175 Full/var
HGY083175 IRAL007P15 pOTB7 BC000022 NM_148176 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380836 RBd52B12 pGCAP10 NM_014337.3  
GGAAGTGGTCACGGAACTCGGCTGCGGCTCCATGGTCTGAGTTGTCAGCCGTTGTTTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl