Prev. |  KEGG KO K13813 > 

RIKEN DNA Bank Human Resource - STX12

Gene ID NCBI Gene 23673 |  KEGG hsa:23673
Gene Symbol STX12
Protein Name syntaxin 12
Synonyms STX13|STX14
Ortholog resource in our bank

  STX12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037207 IRAK093A07 pCMV-SPORT6 BC046999 NM_177424

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048084 ARe20D12 pKA1U5 NM_177424.2  
GGCTTCCGGTAGGAGAGCGGTGTAGAGCGAGCAGGTCTCAGCTCCTCGTCATGTCATACG
HKR222216 ARiS055I24 pGCAP10 NM_177424.2  
GGGCTGGCGGCTGCTTCCGGTAGGAGAGCGGTGTAGAGCGAGCAGGTCTCAGCTCCTCGT
HKR381608 RBd54A08 pGCAP10 NM_177424.2  
GCCCCGCCCTTGCTCTTCCCAGTTTCTCCGTCAGCCTGCGGGNNNNGGCTGGCGGCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl