Prev. |  KEGG KO K12624 > 

RIKEN DNA Bank Human Resource - LSM5

Gene ID NCBI Gene 23658 |  KEGG hsa:23658
Gene Symbol LSM5
Protein Name LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated
Synonyms YER146W
Ortholog resource in our bank

  LSM5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088633 IRAL021J17 pDNR-LIB BC005938 NM_012322 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043659 ARe09C11 pKA1U5 NM_012322.1  
AGAGGCCACTTCCGGCGTAGCCATGGCGGCTAACGCTACTACCAACCCGTCGCAGCTGCT
HKR047678 ARe19D06 pKA1U5 NM_012322.1  
GAGGCCACTTCCGGCGTAGCCATGGCGGCTAACGCTACTACCAACCCGTCGCAGCTGCTG
HKR409139 RBdS022O03 pGCAP10 NM_012322.1  
GACTTCCGGCGTAGCCATGGCGGCTAACGCTACTACCAACCCGTCGCAGCTGCTGCCGTT
HKR420572 RBdS051H04 pGCAP10 NM_012322.1  
GCACTTCCGGCGTAGCCATGGCGGCTAACGCTACTACCAACCCGTCGCAGCTGCTGCCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl