Prev. |  KEGG KO K02321 > 

RIKEN DNA Bank Human Resource - POLA2

Gene ID NCBI Gene 23649 |  KEGG hsa:23649
Gene Symbol POLA2
Protein Name DNA polymerase alpha 2, accessory subunit
Synonyms -
Ortholog resource in our bank

  POLA2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080602 IRAL001I10 pOTB7 BC001347 NM_002689 Full
HGY083831 IRAL009J15 pOTB7 BC002990 NM_002689

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE008008 W01A020A08 pENTR-TOPO IRAL001I10 BC001347 NM_002689  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051282 ARe28D10 pKA1U5 NM_002689.2  
GAGAAGCTCAGCGGTAGCTTTTGGGAAGCAGGACGTTCTCACCAGGAGAGCGTCCTCTCG
HKR218355 ARiS045O19 pGCAP10 NM_002689.2  
HKR277941 ARiS194O05 pGCAP10 NM_002689.2  
GACCACTCAGTTCTGCCACCGTCACTGAGAAGCTCAGCGGTAGCTTTTGGGAAGCAGGAC
HKR367283 RBd18D11 pGCAP10 NM_002689.2  
GCTCACCAGGAGAGCGTCCTCTCGAGATTTCTGCTCCCTCCATTCAGGGCGTTTGGGAGC
HKR378570 RBd46H02 pGCAP10 NM_002689.2  
GATGCGTGCACTGCACAAACCATTTGGCGGGTTTTTCCGGCCACTCAGTTCTGCCACCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl