Prev. |  KEGG KO K16860 > 

RIKEN DNA Bank Human Resource - PLD3

Gene ID NCBI Gene 23646 |  KEGG hsa:23646
Gene Symbol PLD3
Protein Name phospholipase D family member 3
Synonyms AD19|HU-K4|HUK4
Ortholog resources KEGG ortholog (KEGG orthology K16860) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020205 IRAK050I13 pCMV-SPORT6 BC036327 NM_012268
HGY082109 IRAL005E13 pOTB7 BC000553 NM_012268 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048809 ARe22A09 pKA1U5 NM_012268.2  
GACAGCCTGGAAGGTGCGTGTGGGGCTGGGTCTCGGAGTGGGAGACGTGGAGTGCAGGCT
HKR247516 ARiS118N04 pGCAP10 NM_012268.2  
GGAGGGGCCGTCAGGCGGGGATACAGCCTGGAAGGTGCGTGTGGGGCTGGGTCTCGGAGT
HKR345370 RBb63H02 pGCAP1 NM_012268.2  
GGGGCCGTCAGGCGGGGATACAGCCTGGAAGGTGCGTGTGGGGCTGGGTCTCGGAGTGGG
HKR384580 RBd61H12 pGCAP10 NM_012268.2  
GGGGGCCCAGCGGAGGTAGCAGCAGACGCCTGAGAGCGAGGCCGAGGCCCCTCAGGGTTT
HKR406048 RBdS015B24 pGCAP10 NM_012268.2  
GGTCAGGCGGGGATACAGCCTGGAAGGTGCGTGTGGGGCTGGGTCTCGGAGTGGGAGACG
HKR408847 RBdS022B23 pGCAP10 NM_012268.2  
GGCTAGGAGGGGCCGTCAGGCGGGGATACAGCCTGGAAGGTAATGCATGTCCATGGTACA
HKR461736 RBdS154F16 pGCAP10 NM_012268.2  
GGCAGTCTAGCCGTAGTGCGCCTGCGCGCGGCTAGGAGGGGCCGTCAGGCGGGGATACAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl