Prev. |  KEGG KO K09562 > 

RIKEN DNA Bank Human Resource - HSPBP1

Gene ID NCBI Gene 23640 |  KEGG hsa:23640
Gene Symbol HSPBP1
Protein Name HSPA (Hsp70) binding protein 1
Synonyms FES1
Ortholog resources KEGG ortholog (KEGG orthology K09562) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001729 IRAK004F09 pCMV-SPORT6 BC001236 NM_012267 Full
HGY080631 IRAL001J15 pOTB7 BC002373 NM_012267 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166950 ARi17G06 pGCAP10 NM_012267.4  
GAGAGTCNGGTGCGGACCACTTTGTCTGCACGACCCCGGCCGCTTGAGGACCCGGGGAGA
HKR166974 ARi17H06 pGCAP10 NM_012267.4  
GAGAGTCAGGTGCGGACGACTTTGTCTGTAGGAGCAGCGGCGGCTTGAGGACCCGGGGAG
HKR179609 ARi49A09 pGCAP10 NM_012267.4  
GAGAGTCAGGTGCGGACGACTTTGTCTGTAGGAGCAGCGGCGGCTTGAGGACCCGGGGAG
HKR323630 RBb09B06 pKA1U5 NM_012267.4  
GGTTAAGATGGCGGCGCCCAGCAGAGTCAGGTGCGGACGACTTTGTCTGTAGGAGCAGCG
HKR405489 RBdS013M01 pGCAP10 NM_012267.4  
GAGGTGCGGACGACTTTGTCTGTAGGAGCAGCGGCGGCTTGAGGACCCGGGGAGACCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl