Prev. | 

RIKEN DNA Bank Human Resource - FAM89B

Gene ID NCBI Gene 23625 |  KEGG hsa:23625
Gene Symbol FAM89B
Protein Name family with sequence similarity 89 member B
Synonyms LRAP25|MTVR|MTVR1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025681 IRAK064D09 pCMV-SPORT6 BC032373 NM_152832
HGY080993 IRAL002I01 pOTB7 BC023991 NM_152832 Full/var
HGY083937 IRAL009O01 pOTB7 BC023991 NM_152832 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE017523 W01A043N11 pENTR-TOPO IRAK064D09 BC032373 NM_152832  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044883 ARe12D11 pKA1U5 NM_152832.2  
GGGCGGCTGGGCTCCGGCGGGGCCGCGGGGATGCGGGGCCTGCGGGCGGCGGCCCGGGCG
HKR049608 ARe24A08 pKA1U5 NM_152832.2  
GGGGCGGCGGCTGGGCTCCGGCGGGGCCGCGGGGTGCGGGGCCTGCGGGCGGCGGCCCGG
HKR082929 ARf07F09 pKA1U5 NM_152832.2  
GGGCGGGGCCGCGGGGTGCGGGGCCTGCGGGCCCCTTNAAANGGGCGGAGCGTTGGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl