DNA Bank Top |  KEGG KO K04521 > 

RIKEN DNA Bank Human Resource - BACE1

Gene ID NCBI Gene 23621 |  KEGG hsa:23621
Gene Symbol BACE1
Protein Name beta-secretase 1
Synonyms ASP2|BACE|HSPC104
Featured content Alzheimer disease - human

Link

Ortholog resource in our bank

  BACE1

External database

human BACE1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14348 pCAGGS/hBACE1 N153/223S Expression vector of human BACE1mutant, N153S/N223S.    
RDB14347 pCAGGS/hBACE1 N354S Expression vector of human BACE1mutant, N354S.    
RDB14346 pCAGGS/hBACE1 N223S Expression vector of human BACE1mutant, N223S.    
RDB14345 pCAGGS/hBACE1 N172S Expression vector of human BACE1mutant, N172S.    
RDB14344 pCAGGS/hBACE1 N153S Expression vector of human BACE1mutant, N153S.    
RDB14343 pcDNA6/hBACE1 deltaTM-myc-His Expression vector of C-terminal Myc and 6xHis tagged human BACE1 (soluble BACE1).    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019578 IRAK048P18 pBluescriptR BC036084 NM_012104 Full/var
HGY100318 IRAL050N06 pOTB7 BC065492 NM_012104 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR161630 ARi04B06 pGCAP10 NM_138971.2  
GACAAGTCTTTCCGCCTCCCCAGCCCGCCCGGGAGCTGCGAGCCGCGAGCTGGATTATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.24

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl