Prev. |  KEGG KO K15687 > 

RIKEN DNA Bank Human Resource - MKRN1

Gene ID NCBI Gene 23608 |  KEGG hsa:23608
Gene Symbol MKRN1
Protein Name makorin ring finger protein 1
Synonyms RNF61
Ortholog resource in our bank

  MKRN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04952 SEREX clone NGO-Pr-117 (ID 2281) #1 SEREX clone NGO-Pr-117 (ID 2281) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008543 IRAK021F23 pCMV-SPORT6 BC012398 NM_013446 Partial/var
HGX020694 IRAK051M06 pCMV-SPORT6 BC037400 NM_013446 Full/var
HGX056404 IRAK141A04 pCMV-SPORT6 BC064838 NM_013446 Full/var
HGY096973 IRAL042H05 pOTB7 BC025955 NM_013446

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057706 ARe44E10 pKA1U5 NM_013446.2  
GGTGGGATAAACAGTAATGGCGGAGGCTGCAACTCCTGGAACAACAGCCACAACATCAGG
HKR079730 ARe99F10 pKA1U5 NM_013446.2  
GGAGAGCGCTCAGATACGCGACGCGTAGCAGGCGGGGACCGAACGGGTGCCTCAGTGTCC
HKR277755 ARiS194G11 pGCAP10 NM_013446.2  
AAAACAGTAATGGCGGAGGCTGCAACTCCCGGAACAACAGCCACAACATCAGGAGCAGGA
HKR379749 RBd49G05 pGCAP10 NM_013446.2  
GGTGGGATAAACAGTAATGGCGGAGGCTGCAACTCCCGGAACAACAGCCACAACATCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl