Prev. |  KEGG KO K13886 > 

RIKEN DNA Bank Human Resource - CORO1C

Gene ID NCBI Gene 23603 |  KEGG hsa:23603
Gene Symbol CORO1C
Protein Name coronin 1C
Synonyms HCRNN4
Ortholog resources KEGG ortholog (KEGG orthology K13886) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080597 IRAL001I05 pOTB7 BC002342 NM_014325 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044578 ARe11H10 pKA1U5 NM_014325.2  
NNNNNAGTGCCAGGCTGGAGGCGGCAGCGGTTGGAGGCTTCGCCCGGCTTTGCAGCGGGG
HKR050970 ARe27H02 pKA1U5 NM_014325.2  
GGCTCAGTGCCAGGCTGGAGGCGGCAGCGGTTGGAGGCTTCGCCCGGCTTTGCAGCGGGG
HKR071326 ARe78F06 pKA1U5 NM_014325.2  
ATCCTGGGAATGTGTTGGGGGAAGTGGCAGGCTGCGGTGAGAGCTGAGAAGAAAGGGGCT
HKR164058 ARi10C10 pGCAP10 NM_014325.2  
GAGTGCCAGGCTGGAGGCGGCAGCGGTTGGAGGCTTCGCCCGGCTTTGCAGCGGGGACTT
HKR179635 ARi49B11 pGCAP10 NM_014325.2  
GAGTGCCAGGCTGGAGGCGGCAGCGGTTGGAGGCTTCGCCCGGCTTTGCAGCGGGGACTT
HKR180002 ARi50A02 pGCAP10 NM_014325.2  
GAGTGCCAGGCTGGAGGCGGCAGCGGTTGGAGGCTTCGCCCGGCTTTGCAGCGGGGACTT
HKR208320 ARiS020N08 pGCAP10 NM_014325.2  
GAGNNNNNGGCTGGAGGCGGCAGCGGTTGGAGGCTTCGCCCGGCTTTGCAGCGGGGACTT
HKR264650 ARiS161K10 pGCAP10 NM_014325.2  
GGCCNGGCTGGAGGCGNCANCGGTTGGAGGCTTCGCCCGGCTTTGCAGCGGGGACTTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl