Prev. | 

RIKEN DNA Bank Human Resource - HEBP2

Gene ID NCBI Gene 23593 |  KEGG hsa:23593
Gene Symbol HEBP2
Protein Name heme binding protein 2
Synonyms C6ORF34B|C6orf34|PP23|SOUL
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001540 IRAK003O04 pCMV-SPORT6 BC010290 NM_014320 Full
HGX005403 IRAK013I11 pCMV-SPORT6 BC008205 NM_014320 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR179346 ARi48G02 pGCAP10 NM_014320.2  
TGGGTCGCCGCGGAGGGGCGGGGGCAGGACGCGCAACTCCGGCCGGAGCTGTCCGGGGTC
HKR184001 ARi60A01 pGCAP10 NM_014320.2  
AGGACGCGCAACTCCGGCCGGAGCTGTCCGGGGTCGTGAGCCGGCCCCGCCTTGGTGGCG
HKR332504 RBb31E08 pGCAP1 NM_014320.2  
GGCCCATGGCCGAGCCGCTCCAGCCAGACCCCGGGGCGGCCGANGACGCGGCGGCCCAAG
HKR333372 RBb33H04 pGCAP1 NM_014320.2  
GGCCCATGGCCGAGCCGCTCCAGCCAGACCCCGGGGCGGCCGAGGACGCGGCGGCCCAAG
HKR444159 RBdS110G15 pGCAP10 NM_014320.2  
GGGTGGCGGCGCCCCCTCGCGGTCCAGAGGCAGACGCATCGGGTGGGCTCGGGTCTCCAG
HKR462590 RBdS156H22 pGCAP10 NM_014320.2  
GGGGTGGGCTCGGGTCTCCAGCCCGGCCGGGAGGAGGGACCGGCTCTGCGGAGCGGGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl