Prev. | 

RIKEN DNA Bank Human Resource - CARHSP1

Gene ID NCBI Gene 23589 |  KEGG hsa:23589
Gene Symbol CARHSP1
Protein Name calcium regulated heat stable protein 1
Synonyms CRHSP-24|CRHSP24|CSDC1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001215 IRAK003A15 pCMV-SPORT6 BC003366 NM_014316 Full/var
HGY083171 IRAL007P11 pOTB7 BC000782 NM_014316 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024645 W01A061K05 pENTR-TOPO IRAK003A15 BC003366 NM_014316  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062104 ARe55E08 pKA1U5 NM_014316.2  
GGCTGGCGGAGCANAACGGATTGCAGGGGTCAGCCATGTTCATCTGAGCCTCCCCCACCA
HKR218315 ARiS045N03 pGCAP10 NM_014316.2  
GAGTCGGANCNAANCGGCTGGCGGAGCAGAACGGATTGCAGGGTCAGCCATGTCATCTGA
HKR238441 ARiS096B17 pGCAP10 NM_014316.2  
GAGTCGGAGCGAAGCGGCTGGCGGAGCANAACGGATTGCAGGGTCAGCCATGTCATCTGA
HKR335611 RBb39A11 pGCAP1 NM_014316.2  
AATGTGGAGTCGGAGCGAAGCGGCTGGCGGAGCAGAACGGATTGCAGGGTCAGCCATGTC
HKR344479 RBb61D07 pGCAP1 NM_014316.2  
AAAGCGGAGCGAAGCGGCTGGCGGAGCAGAACGGATTGCAGGGTCAGCCATGTCATCTGA
HKR366812 RBd17A12 pGCAP10 NM_014316.2  
GGCGCTCTCAGTCGGAGCGAAGCGGCTGGCGGAGCAGAACGGATTGCAGGGTCAGCCATG
HKR474912 RBdS187E16 pGCAP10 NM_014316.2  
GGGAGCGAAGCGGCTGGCGGAGCAGAACGGATTGCAGGGTCAGCCATGTCATCTGAGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl