Prev. | Human A to Z list > D > 

RIKEN DNA Bank Human Resource - DDX58

Gene ID (NCBI) 23586
Gene Symbol DDX58
Protein Name DExD/H-box helicase 58
Synonyms RIG-I|RIGI|RLR-1|SGMRT2
Databases KEGG hsa:23586 |  NCBI Gene 23586
Featured content NF-kappa B signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12646)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR171208 ARi28A08 pGCAP10 NM_014314.3 done
GGCCCTCCTGCTACCCGGCTTTAAAGCTAGTGAGGCACAGCCTGCGGGGAACGTAGCTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl