Prev. |  KEGG KO K12646 > 

RIKEN DNA Bank Human Resource - DDX58

Gene ID NCBI Gene 23586 |  KEGG hsa:23586
Gene Symbol DDX58
Protein Name DExD/H-box helicase 58
Synonyms RIG-I|RIG1|RIGI|RLR-1|SGMRT2
Featured content NF-kappa B signaling pathway (human)
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  DDX58

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171208 ARi28A08 pGCAP10 NM_014314.3 done
GGCCCTCCTGCTACCCGGCTTTAAAGCTAGTGAGGCACAGCCTGCGGGGAACGTAGCTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl