Prev. | 

RIKEN DNA Bank Human Resource - TMEM50A

Gene ID NCBI Gene 23585 |  KEGG hsa:23585
Gene Symbol TMEM50A
Protein Name transmembrane protein 50A
Synonyms IFNRC|SMP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066877 IRAK167D05 pBluescriptR BC066908 -
HGY089716 IRAL024E20 pOTB7 BC007341 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE028401 W01A071A01 pENTR-TOPO IRAK167D05 BC066908 -  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040834 ARe02B10 pKA1U5 NM_014313.2  
GACTGCTGCATCCGGGTGTCTGGAGGCTGTGGCCGTTTTGTTTTCTTGGCTAAAATCGGG
HKR046928 ARe17F08 pKA1U5 NM_014313.2  
GACTGCTGCATCCGGGTGTCTGGAGGCTGTGGCCGTTTTGTTTTCTTGGCTAAAATCGGG
HKR062479 ARe56D07 pKA1U5 NM_014313.2  
GGAGCCGGGTGGATGGTACTGCTGCATCCGGGCGTCTGGAGGCTGTGGCCGTTTTGTTTT
HKR073299 ARe83E03 pKA1U5 NM_014313.2  
GACTGCTGCATCCGGGTGTCTGGAGGCTGTGGCCGTTTTGTTTTCTTGGCTAAAATCGGG
HKR209364 ARiS023G20 pGCAP10 NM_014313.2  
GAGGAGAAGGCGACGGCGTCCAGACCCCGCCAAGACGGAGAGGGGACCGCGCCCTCCCCC
HKR279556 ARiS198O20 pGCAP10 NM_014313.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl