Prev. |  KEGG KO K10800 > 

RIKEN DNA Bank Human Resource - SMUG1

Gene ID NCBI Gene 23583 |  KEGG hsa:23583
Gene Symbol SMUG1
Protein Name single-strand-selective monofunctional uracil-DNA glycosylase 1
Synonyms FDG|HMUDG|UNG3
Featured content DNA repair (human)
Ortholog resource in our bank

  SMUG1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080712 IRAL001M24 pOTB7 BC000417 NM_014311 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170073 ARi25D01 pGCAP10 NM_014311.1  
TTGGGGATGGGGAGCTGGACCAGCAGATTATGAGCTTACAGAAAGCCTGGCCTACATTTT
HKR183258 ARi58C10 pGCAP10 NM_014311.1  
GNACCAGGTGAGGANNNNGGNCTGGNATCCGGNCTGTGGGGCAGTTGACNCTCCAGGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl