Prev. |  KEGG KO K21626 > 

RIKEN DNA Bank Human Resource - CCNDBP1

Gene ID NCBI Gene 23582 |  KEGG hsa:23582
Gene Symbol CCNDBP1
Protein Name cyclin D1 binding protein 1
Synonyms DIP1|GCIP|HHM
Ortholog resource in our bank

  CCNDBP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005795 IRAK014I03 pCMV-SPORT6 BC009689 NM_037370 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE084808 M01C012A08 pDONR221 FLJ03-F04 AK075296 NM_037370  
HGE084856 M01C012C08 pDONR221 FLJ03-F04 AK075296 NM_037370  
HGE084904 M01C012E08 pDONR221 FLJ03-F04 AK075296 NM_037370  
HGE084952 M01C012G08 pDONR221 FLJ03-F04 AK075296 NM_037370  
HGE085000 M01C012I08 pDONR221 FLJ03-F04 AK075296 NM_037370  
HGE085048 M01C012K08 pDONR221 FLJ03-F04 AK075296 NM_037370  
HGE085096 M01C012M08 pDONR221 FLJ03-F04 AK075296 NM_037370  
HGE085144 M01C012O08 pDONR221 FLJ03-F04 AK075296 NM_037370  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR179372 ARi48H04 pGCAP10 NM_012142.2  
GAGGGCAGGGCCTCTGGGACGGGGCTGGACGGCTTGTTGACGGAAACGAGCCCTTGACGC
HKR243668 ARiS109C20 pGCAP10 NM_012142.2  
GGCCCTTGACGCTGTGGCCCGGAAGTGGAGCGGCTGTCGCAGTGCGGCTCCGGCAGTGGC
HKR341680 RBb54D08 pGCAP1 NM_012142.2  
TGGGAAACGAGCCCTTGACGCTGTGGCCCGGAAGTGGAGCGGCTGTCGCAGTGCGGCTCC
HKR441962 RBdS104P02 pGCAP10 NM_012142.2  
GGGGCGGGGCCGGGCCTCGTGGCGGGAGGAGGCAGGGCAGGGCCTCTGGGACGGGGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl