Prev. |  KEGG KO K01482 > 

RIKEN DNA Bank Human Resource - DDAH1

Gene ID NCBI Gene 23576 |  KEGG hsa:23576
Gene Symbol DDAH1
Protein Name dimethylarginine dimethylaminohydrolase 1
Synonyms DDAH|DDAH-1|DDAHI|HEL-S-16
Ortholog resource in our bank

  DDAH1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027489 IRAK068M01 pCMV-SPORT6 BC033680 NM_012137 Full
HGY028303 IRAK070M15 pBluescriptR BC036432 NM_012137 Partial/var
HGY030631 IRAK076J15 pBluescriptR BC043235 NM_012137 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062950 ARe57G06 pKA1U5 NM_012137.3  
ATCCTGATTCAGCGGCTGCCAAGAGGAGCCGACGGGCGCTCGCAGGCTCAGCGCGCGCTG
HKR184029 ARi60B05 pGCAP10 NM_012137.3  
CGGCCGGCCGATATCGTGTGGTACCGCGGCCGCGGATCTCCCTTTAGTGAGGGTTAATTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl