Prev. |  KEGG KO K06943 > 

RIKEN DNA Bank Human Resource - GTPBP4

Gene ID NCBI Gene 23560 |  KEGG hsa:23560
Gene Symbol GTPBP4
Protein Name GTP binding protein 4
Synonyms CRFG|NGB|NOG1
Ortholog resources KEGG ortholog (KEGG orthology K06943) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027341 IRAK068F21 pCMV-SPORT6 BC033784 NM_012341 Partial
HGX032952 IRAK082G08 pCMV-SPORT6 BC038975 NM_012341 Full
HGY092054 IRAL030C06 pOTB7 BC021243 NM_012341 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055280 ARe38D08 pKA1U5 NM_012341.2  
GGGAAGTTCCGGGAGTGCCAAGCTACCCGCGTGCATACGGCTGCCGGCATGGCACATTAC
HKR187211 ARi68A11 pGCAP10 NM_012341.2  
GAGTTCCGGGAGTGCCAAGTACCCGCGTGCATACGGCTGCCGGCATGGCACATTACAACT
HKR238682 ARiS096L18 pGCAP10 NM_012341.2  
GGCGTGCATACGGCTGCCGGCATGGCACATTACAACTTCAAGAAAATTACGGTGGTGCCG
HKR336854 RBb42C06 pGCAP1 NM_012341.2  
GGCGGAGTGCCAAGCTACCCGCGTTGCATACGGCTGCCGGCATGGCACATTACAACTTCA
HKR374580 RBd36H12 pGCAP10 NM_012341.2  
GCGGGAGTGCCAAGTACCCGCGTGCATACGGCTGCCGGCATGGCACATTACAACTTCAAG
HKR394434 RBd86B10 pGCAP10 NM_012341.2  
GTCCCACCTGCGCCCGACGGCGGAAGTTCCGGGAGTGCCAAGTACCCGCGTGCATACGGC
HKR433275 RBdS083D03 pGCAP10 NM_012341.2  
TGGCATACGGCTGCCGGCATGGCACATTACAACTTCAAGAAAATTACGGTGGTGCCGTCC
HKR442314 RBdS105N02 pGCAP10 NM_012341.2  
GGGGAGTGCCAAGTACCCGCGTGCATACGGTTGCCGGCATGGCACATTACAACTTCAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl