Prev. |  KEGG KO K02154 > 

RIKEN DNA Bank Human Resource - ATP6V0A2

Gene ID NCBI Gene 23545 |  KEGG hsa:23545
Gene Symbol ATP6V0A2
Protein Name ATPase H+ transporting V0 subunit a2
Synonyms A2|ARCL|ARCL2A|ATP6A2|ATP6N1D|J6B7|RTF|STV1|TJ6|TJ6M|TJ6S|VPH1|WSS
Ortholog resources KEGG ortholog (KEGG orthology K02154) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001775 IRAK004H07 pCMV-SPORT6 BC000826 NM_012463
HGY067532 IRAK168N20 pBluescriptR BC068531 NM_012463 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE023169 W01A057P09 pENTR-TOPO IRAK168N20 BC068531 NM_012463  
HGE023171 W01A057P11 pENTR-TOPO IRAK168N20 BC068531 NM_012463  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR395632 RBd89B08 pGCAP10 NM_012463.2  
CGGCCGGCCGATGGCGGACTGCTGTGGCGGCAGCTGGAGCGGCGGCCGCGGTGGCAGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl