Prev. |  KEGG KO K14946 > 

RIKEN DNA Bank Human Resource - RBFOX2

Gene ID NCBI Gene 23543 |  KEGG hsa:23543
Gene Symbol RBFOX2
Protein Name RNA binding fox-1 homolog 2
Synonyms FOX2|Fox-2|HNRBP2|HRNBP2|RBM9|RTA|dJ106I20.3|fxh
Ortholog resource in our bank

  RBFOX2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010734 IRAK026N22 pCMV-SPORT6 BC013115 NM_014309 Full/var
HGY096880 IRAL042D08 pOTB7 BC025281 NM_001031695 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009467 W01A023L03 pENTR-TOPO IRAL042D08 BC025281 NM_001031695  
HGE009471 W01A023L07 pENTR-TOPO IRAL042D08 BC025281 NM_001031695  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164155 ARi10G11 pGCAP10 NM_014309.2  
GTTCCTTCAGCCATCTGCCTGAGATATGGGAGGGAGCTGGAGAAAGAAGGAGGGGGAGAG
HKR247263 ARiS118C15 pGCAP10 NM_014309.2  
GAGGGGGGNNNGACTGCCAGANAGGAAGAGAAAAGAAAGGAAGAAACATTAGAAAGAAAA
HKR376402 RBd41A02 pGCAP10 NM_014309.2  
TGGGGGAGAGACTGCCAGAGAGGAAGAGAAAAGAAAGGAAGAAACATTAGAAAGAAAAAG
HKR408959 RBdS022G15 pGCAP10 NM_014309.2  
GNGACTGCCNGAGAGGAAGAGAAAAGAAAGGAAGAAACATTAGAAAGAAAAAGGAAGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl