Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NNT

Gene ID (NCBI) 23530
Gene Symbol NNT
Protein Name nicotinamide nucleotide transhydrogenase
Synonyms GCCD4
Databases KEGG hsa:23530 |  NCBI Gene 23530
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00323)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR279232 ARiS198B08 pGCAP10 NM_012343.3  
CGGCCGGCCGATGGTTCTGATTTTTCCTAGCGAGCTGGAGGAAAGGCAGGTACCCGGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl