Prev. |  KEGG KO K00323 > 

RIKEN DNA Bank Human Resource - NNT

Gene ID NCBI Gene 23530 |  KEGG hsa:23530
Gene Symbol NNT
Protein Name nicotinamide nucleotide transhydrogenase
Synonyms GCCD4
Ortholog resource in our bank

  NNT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR279232 ARiS198B08 pGCAP10 NM_012343.4 full done
CGGCCGGCCGATGGTTCTGATTTTTCCTAGCGAGCTGGAGGAAAGGCAGGTACCCGGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl