Prev. |  KEGG KO K12598 > 

RIKEN DNA Bank Human Resource - MTREX

Gene ID NCBI Gene 23517 |  KEGG hsa:23517
Gene Symbol MTREX
Protein Name Mtr4 exosome RNA helicase
Synonyms Dob1|KIAA0052|Mtr4|SKIV2L2|fSAP118
Ortholog resource in our bank

  MTREX

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011795 IRAK029I03 pCMV-SPORT6 BC031779 NM_015360 Partial/var
HGY018567 IRAK046G23 pBluescriptR BC028604 NM_015360 Full/var
HGX056229 IRAK140J13 pCMV-SPORT6 BC065258 NM_015360 Full/var
HGY093604 IRAL034A04 pOTB7 BC014669 NM_015360 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024001 W01A060A01 pENTR-TOPO IRAK046G23 BC028604 NM_015360  
HGE024003 W01A060A03 pENTR-TOPO IRAK046G23 BC028604 NM_015360  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046008 ARe15A08 pKA1U5 NM_015360.4  
GACTCACTGCTCCCAAAAATGGCGGACGCATTCGGAGATGAGCTGTTCAGCGTGTTCGAG
HKR361772 RBd04H04 pGCAP10 NM_015360.4  
GGATTTGCTCTCACTGCTCCCAAAAATGGCGGACGCATTCGGAGATGAGCTGTTCAGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl