Prev. |  KEGG KO K21914 > 

RIKEN DNA Bank Human Resource - KCTD2

Gene ID NCBI Gene 23510 |  KEGG hsa:23510
Gene Symbol KCTD2
Protein Name potassium channel tetramerization domain containing 2
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K21914) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005658 IRAK014C10 pCMV-SPORT6 BC009633 NM_015353 Partial/var
HGY028955 IRAK072G11 pBluescriptR BC033329 NM_015353 Partial/var
HGX043063 IRAK107K23 pCMV-SPORT6 BC047910 NM_015353
HGY103849 IRAL059K09 pOTB7 BC080561 NM_015353

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR320977 RBb02H09 pKA1U5 NM_015353.1  
GCCCGGCCCGGCTCTCCCTGCCGAGAAATGGGCCGGCCCGGCTGCGCGCGGGCAGCAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl