Prev. |  KEGG KO K03691 > 

RIKEN DNA Bank Human Resource - POFUT1

Gene ID NCBI Gene 23509 |  KEGG hsa:23509
Gene Symbol POFUT1
Protein Name protein O-fucosyltransferase 1
Synonyms DDD2|FUT12|O-FUT|O-Fuc-T|O-FucT-1|OFUCT1
Ortholog resources KEGG ortholog (KEGG orthology K03691) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082345 IRAL005O09 pOTB7 BC000582 NM_172236 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038487 W01A096D15 pENTR-TOPO IRAL005O09 BC000582 NM_172236  
HGE038489 W01A096D17 pENTR-TOPO IRAL005O09 BC000582 NM_172236  
HGE038527 W01A096F07 pENTR-TOPO IRAL005O09 BC000582 NM_172236  
HGE047939 W01A119O03 pENTR-TOPO IRAL005O09 BC000582 NM_172236  
HGE047943 W01A119O07 pENTR-TOPO IRAL005O09 BC000582 NM_172236  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048507 ARe21E11 pKA1U5 NM_015352.1  
GCCCTCCTTCCCTCCCCGACTGTGCGCCGCGGCTGGCTCGGGTTCCCGGGCCGACATGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl