DNA Bank Top | 

RIKEN DNA Bank Human Resource - ISCU

Gene ID NCBI Gene 23479 |  KEGG hsa:23479
Gene Symbol ISCU
Protein Name iron-sulfur cluster assembly enzyme
Synonyms 2310020H20Rik|HML|ISU2|NIFU|NIFUN|hnifU

Link

Ortholog resource in our bank

External database

human ISCU

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14212 pGL3/hISCU_p53 BR Reporter plasmid of human ISCU gene.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053643 IRAK134B19 pCMV-SPORT6 BC061903 NM_213595 Full
HGY091444 IRAL028K04 pOTB7 BC011906 NM_213595 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR065325 ARe63F05 pKA1U5 NM_213595.2  
GGGACTGGCGCAGGCGCAAGCCGGCAAGATGGCGGCGGCTGGGGCTTTCCGTCTGAGGCG
HKR170026 ARi25B02 pGCAP10 NM_213595.2  
GGCAGGCGCAAGCCGGCAAGATGGCGGCGGCTGGGGCTTTCCGTCTGAGGCGGGCGGCAT
HKR361776 RBd04H08 pGCAP10 NM_213595.2  
GGGCAAGATGGCGGCGGCTGGGGCTGGCCGTCTGAGGCGGGTGGCATCGGCTCTGCTGCT
HKR392074 RBd80D02 pGCAP10 NM_213595.2  
GAAGCCGGCAAGATGGCGGCGGCTGGGGCTGGCCGTCTGAGGCGGGTGGCATCGGCTCTG
HKR396854 RBd92C06 pGCAP10 NM_213595.2  
GAAGCCGGCAAGATGGCGGCGGCTGGGGCTGGCCGTCTGAGGCGGGTGGCATCGGCTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.24

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl