Prev. |  KEGG KO K00767 > 

RIKEN DNA Bank Human Resource - QPRT

Gene ID NCBI Gene 23475 |  KEGG hsa:23475
Gene Symbol QPRT
Protein Name quinolinate phosphoribosyltransferase
Synonyms HEL-S-90n|QPRTase
Ortholog resources KEGG ortholog (KEGG orthology K00767) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086326 IRAL015N14 pOTB7 BC018910 NM_014298 Full
HGY087221 IRAL018A21 pOTB7 BC005060 NM_014298 Full/var
HGY090869 IRAL027C21 pOTB7 BC010033 NM_014298 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098430 M01C046B06 pDONR221 MGC12-H03 BC018910 ENST00000219771  
HGE098478 M01C046D06 pDONR221 MGC12-H03 BC018910 ENST00000219771  
HGE098526 M01C046F06 pDONR221 MGC12-H03 BC018910 ENST00000219771  
HGE098574 M01C046H06 pDONR221 MGC12-H03 BC018910 ENST00000219771  
HGE098622 M01C046J06 pDONR221 MGC12-H03 BC018910 ENST00000219771  
HGE098670 M01C046L06 pDONR221 MGC12-H03 BC018910 ENST00000219771  
HGE098718 M01C046N06 pDONR221 MGC12-H03 BC018910 ENST00000219771  
HGE098766 M01C046P06 pDONR221 MGC12-H03 BC018910 ENST00000219771  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR361657 RBd04C09 pGCAP10 NM_014298.3  
GAGACAGCTGCAAGTCACCATGGACGCTGAAGGCCTGGCGCTGCTGCTGCCGCCCGTCAC
HKR452904 RBdS132E08 pGCAP10 NM_014298.3  
GAGCCTGGGGCCTCTGGGAGCCTTGGTCCTGAGCAGCCAACACACCAGCCCAGACAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl