Prev. |  KEGG KO K17725 > 

RIKEN DNA Bank Human Resource - ETHE1

Gene ID NCBI Gene 23474 |  KEGG hsa:23474
Gene Symbol ETHE1
Protein Name ETHE1 persulfide dioxygenase
Synonyms HSCO|YF13H12
Ortholog resource in our bank

  ETHE1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005487 IRAK013L23 pCMV-SPORT6 BC008250 NM_014297 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050104 ARe25E08 pKA1U5 NM_014297.3  
GGTCAGTGCCGTAGCGCCCGGCTCCTGCAGGCGCTCGGCCTCCGCTCATTCCTGACCCCG
HKR178897 ARi47E01 pGCAP10 NM_014297.3  
GATTCCTGACCCCGCAGTGGGCGCGATGGCGGAGGCTGTACTGAGGGTCGCCCGGCGGCA
HKR376430 RBd41B06 pGCAP10 NM_014297.3  
TGCCTGACCCCGCAGTGGGCGCGATGGCGGAGGCTGTACTGAGGGTCGCCCGGCGGCAGC
HKR378949 RBd47G05 pGCAP10 NM_014297.3  
GCCTGACCCCGCAGTGGGCGCGATGGCGGAGGCTGTACTGAGGGTCGCCCGGCGGCAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl