Prev. |  KEGG KO K14010 > 

RIKEN DNA Bank Human Resource - TRAM1

Gene ID NCBI Gene 23471 |  KEGG hsa:23471
Gene Symbol TRAM1
Protein Name translocation associated membrane protein 1
Synonyms PNAS8|TRAM|TRAMP
Ortholog resource in our bank

  TRAM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018922 IRAK047F02 pBluescriptR BC037738 NM_014294 Full
HGY028504 IRAK071E08 pBluescriptR BC032018 NM_014294 Partial/var
HGY082274 IRAL005L10 pOTB7 BC000687 NM_014294 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100040 M01C050B16 pDONR221 MGC14-H08 BC000687 NM_014294  
HGE100088 M01C050D16 pDONR221 MGC14-H08 BC000687 NM_014294  
HGE100136 M01C050F16 pDONR221 MGC14-H08 BC000687 NM_014294  
HGE100184 M01C050H16 pDONR221 MGC14-H08 BC000687 NM_014294  
HGE100232 M01C050J16 pDONR221 MGC14-H08 BC000687 NM_014294  
HGE100280 M01C050L16 pDONR221 MGC14-H08 BC000687 NM_014294  
HGE100328 M01C050N16 pDONR221 MGC14-H08 BC000687 NM_014294  
HGE100376 M01C050P16 pDONR221 MGC14-H08 BC000687 NM_014294  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042176 ARe05H08 pKA1U5 NM_014294.4  
GGGGGCCGTGAGGAGCAGCCAGCGGGAGGCGGCGGCGAGTCGGTGAGCAGCTGGGAAGAG
HKR174949 ARi37G05 pGCAP10 NM_014294.4  
GGGGATGGGAAGTGAAGCCCCAGCGAGCGGCTGCAGCGGGGCCGTGAGGAGCAGCCAGCG
HKR178977 ARi47H09 pGCAP10 NM_014294.4  
GAGCGGGAGGCGGCGGCGAGTCGGTGAGCAGCTGGGAAGAGCAGAACCGGGGCGGAGCAC
HKR180854 ARi52C06 pGCAP10 NM_014294.4  
GGTGAGGAGCAGCCAGCGGGAGGCGGCGGCGAGTCGGTGAGCAGCTGGGAAGAGCAGAAC
HKR180878 ARi52D06 pGCAP10 NM_014294.4  
GGTGAGGAGCAGCCAGCGGGAGGCGGCGGCGAGTCGGTGAGCAGCTGGGAAGAGCAGAAC
HKR218336 ARiS045N24 pGCAP10 NM_014294.4  
GAGCGAGCGGCTGCANCGGGGCCGTGAGGAGCAGCCAGCGGGAGGCGGCGGCNAGTCGGT
HKR234109 ARiS085E13 pGCAP10 NM_014294.4  
GAGAACCGGGGCGGAGCACCTGCAGGCGCGGGCGGCGGCCCCACCATGGCGATTCGCAAG
HKR363701 RBd09E05 pGCAP10 NM_014294.4  
GAGTGAAGCCCCAGCGAGCGGCTGCAGCGGGGCCGTGAGGAGCAGCCAGCGGGAGGCGGC
HKR372506 RBd31E10 pGCAP10 NM_014294.4  
GGGCGGCCCCACCATGGCGATTCGCAAGAAAAGCACCAAGAGCCCCCCAGTGCTGAGCCA
HKR428196 RBdS070I04 pGCAP10 NM_014294.4  
GATGCTCGCCCCCGCTGCGGGCTAGCTGTTGTGTTTTTTTTTTTTCCCCCGGGCGGCCCG
HKR461978 RBdS154P18 pGCAP10 NM_014294.4  
GAGAACCGGGGCGGAGCACCTGCAGGCGCGGGCGGCGGCCCCACCATGGCGATTCGCAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl