Prev. |  KEGG KO K11587 > 

RIKEN DNA Bank Human Resource - CBX5

Gene ID NCBI Gene 23468 |  KEGG hsa:23468
Gene Symbol CBX5
Protein Name chromobox 5
Synonyms HEL25|HP1|HP1A
Ortholog resource in our bank

  CBX5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001324 IRAK003F04 pCMV-SPORT6 BC006821 NM_012117 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004751 W01A011O15 pENTR-TOPO IRAK003F04 BC006821 NM_012117  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR338834 RBb47B10 pGCAP1 NM_012117.2  
GAGGCCCCTCCTGTTAGCCCAGAGGGAAAGAAAGAACTGGGGCGATCCGGGACCCGGTGG
HKR384408 RBd61A08 pGCAP10 NM_012117.2  
GGGGCGGTTGGCGTTGCGCAGAAGGCGGCGGCGGTGGTGGCTTGTGGTGCGGCCTCACCA
HKR396456 RBd91C08 pGCAP10 NM_012117.2  
GGTTAGCCCAGAGGGAAAGAAAGAACTGGGGCGATCCGGTAGGTAAAGGAGGGAACCCCC
HKR432487 RBdS081D15 pGCAP10 NM_012117.2  
GAGAAGGCGGCGGCGGTGGTGGCTTGTGGTGCGGCCTCACCATACAGGAACAGGGCAGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl