Prev. |  KEGG KO K00587 > 

RIKEN DNA Bank Human Resource - ICMT

Gene ID NCBI Gene 23463 |  KEGG hsa:23463
Gene Symbol ICMT
Protein Name isoprenylcysteine carboxyl methyltransferase
Synonyms HSTE14|MST098|MSTP098|PCCMT|PCMT|PPMT
Ortholog resource in our bank

  ICMT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025123 IRAK062N11 pCMV-SPORT6 BC028168 NM_012405 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018501 W01A046E05 pENTR-TOPO IRAK062N11 BC028168 NM_012405  
HGE018505 W01A046E09 pENTR-TOPO IRAK062N11 BC028168 NM_012405  
HGE018511 W01A046E15 pENTR-TOPO IRAK062N11 BC028168 NM_012405  
HGE018545 W01A046G01 pENTR-TOPO IRAK062N11 BC028168 NM_012405  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238469 ARiS096C21 pGCAP10 NM_012405.3  
GGCTAGTCCGCCGCCCGGCGCCATGGCGGGCTGCGCGGCGCGGGCTCCGCCGGGCTCTGA
HKR264723 ARiS161N11 pGCAP10 NM_012405.3  
GGGGCNNCNNCCGGCGCCGCCNCCCGCTAGTCCGCCGCCCGGCGCCATGGCGGGCTGCGC
HKR461904 RBdS154M16 pGCAP10 NM_012405.3  
GCCGCTAGTCCGCCGCCCGGCGCCATGGCGGGCTGCGCGGCGCGGGCTCCGCCGGGCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl