Prev. |  KEGG KO K01892 > 

RIKEN DNA Bank Human Resource - HARS2

Gene ID NCBI Gene 23438 |  KEGG hsa:23438
Gene Symbol HARS2
Protein Name histidyl-tRNA synthetase 2, mitochondrial
Synonyms HARSL|HARSR|HO3|HisRS|PRLTS2
Ortholog resource in our bank

  HARS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085046 IRAL012K06 pOTB7 BC007680 NM_012208 Full
HGY093726 IRAL034F06 pOTB7 BC014982 NM_012208 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR386931 RBd67F11 pGCAP10 NM_012208.2  
GAAGGGAACTTGGGAGGATCCCACCTCAGCCTTCGTGACTAGTGAGGTGCGCAAACGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl