Prev. | 

RIKEN DNA Bank Human Resource - TARDBP

Gene ID NCBI Gene 23435 |  KEGG hsa:23435
Gene Symbol TARDBP
Protein Name TAR DNA binding protein
Synonyms ALS10|TDP-43
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04974 SEREX clone NGO-Pr-5 (ID 597, 598) #1 SEREX clone NGO-Pr-5 (ID 597, 598) #1
RDB15499 AxDsR-WT.TDP43 Recombinant adenovirus vector of human TAR DNA-binding protein 43 (TDP-43), wild type, tagged with DsRed monomer.
RDB15500 AxDsR-CTF.TDP43 Recombinant adenovirus vector of human TAR DNA-binding protein 43 (TDP-43), C-terminal fragment, tagged with DsRed monomer.
RDB15742 CMV:TDP43-GFP Expression vector of human TDP43.
RDB15743 CMV:GFP-TDP25 Expression vector of 25 kDa C-terminal fragment (TDP25) of TDP43.
RDB15744 CMV:GFP-NLS-TDP25 Expression vector of 25 kDa C-terminal fragment (TDP25) of TDP43.
RDB15745 CMV:GFP-NLSNP-TDP25 Expression vector of 25 kDa C-terminal fragment (TDP25) of TDP43.
RDB16710 pGEX6P-TDP43WT-6xHis Expression vector of human TAR DNA-binding protein 43 (TDP43).
RDB16711 pGEX6P-TDP43A315T-6xHis Expression vector of human TAR DNA-binding protein 43 (TDP43), amyotrophic lateral sclerosis (ALS)-associated A315T mutant.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066714 IRAK166N02 pCMV-SPORT6 BC071657 NM_007375 Full
HGX053759 IRAK134G15 pCMV-SPORT6 BC059955 NM_007375 Partial/var
HGY083179 IRAL007P19 pOTB7 BC001487 NM_007375 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE020017 W01A050A17 pENTR-TOPO IRAK166N02 BC071657 NM_007375 done
HGE020019 W01A050A19 pENTR-TOPO IRAK166N02 BC071657 NM_007375  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR361681 RBd04D09 pGCAP10 NM_007375.3  
GGCCTTTTCCTCCTTGCCTATCTGAGGCTGGGCTGCGCTTGGGTCCGTCCCTGCTTCAGC
HKR367749 RBd19G05 pGCAP10 NM_007375.3  
GGTTACGTGGGGGGAGGTCAGCTCCTATACAGCCACACTTTTTTCAATCTTCAGCTTTTC
HKR389732 RBd74F12 pGCAP10 NM_007375.3  
GGTGGGAGCGAAGCGGTGGCTGGGCTGCGCTTGGGTCCGTCGCTGCTTCGGTGTCCCTGT
HKR462528 RBdS156F08 pGCAP10 NM_007375.3  
GGCCATTTTGTGGGAGCGAAGCGGTGGCTGGGCTGCGCTTGGGTCCGTCGCTGCTTCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.22

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl