Prev. |  KEGG KO K13781 > 

RIKEN DNA Bank Human Resource - SLC7A8

Gene ID NCBI Gene 23428 |  KEGG hsa:23428
Gene Symbol SLC7A8
Protein Name solute carrier family 7 member 8
Synonyms LAT2|LPI-PC1
Ortholog resource in our bank

  SLC7A8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031319 IRAK078E23 pCMV-SPORT6 BC036825 NM_182728 Full/var
HGY098979 IRAL047H11 pOTB7 BC052250 NM_182728 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR277965 ARiS194P05 pGCAP10 NM_012244.2  
GAGTGTGTGGAGAAGCCACTCTCCCGAAACCAGAGGGATGGGGCCGGCTGTGCAGTAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl