Prev. |  KEGG KO K20350 > 

RIKEN DNA Bank Human Resource - TMED3

Gene ID NCBI Gene 23423 |  KEGG hsa:23423
Gene Symbol TMED3
Protein Name transmembrane p24 trafficking protein 3
Synonyms C15orf22|P24B|p24g4|p24gamma4|p26
Ortholog resource in our bank

  TMED3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005607 IRAK014A07 pCMV-SPORT6 BC010853 NM_007364 Full
HGX006341 IRAK015O05 pCMV-SPORT6 BC017495 NM_007364 Full
HGX008825 IRAK022B01 pCMV-SPORT6 BC022232 NM_007364 Full
HGY082908 IRAL007E12 pOTB7 BC000027 NM_007364 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004434 W01A011B10 pENTR-TOPO IRAK015O05 BC017495 NM_007364  
HGE004438 W01A011B14 pENTR-TOPO IRAK015O05 BC017495 NM_007364  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047321 ARe18F01 pKA1U5 NM_007364.2  
GACTTTGAGCGCGCGGCTGCGCACTGAGCCGCCGGCCCTCCCGGAAGCGCAGAGCTCCGC
HKR068570 ARe71H02 pKA1U5 NM_007364.2  
GCCTNCCNGCAAGNGCAGAGNTCCNCGTGGCTGCCACNCTTTATCACCGNTACATNCNCC
HKR170051 ARi25C03 pGCAP10 NM_007364.2  
GGGTAGTCGTCGCCCCAGCCCGCCGGGGGCGCAGCGCCCGAGCCGCGGCCCTCGAGACGG
HKR205305 ARiS013E09 pGCAP10 NM_007364.2  
GGGTAGTCGTCGCCCCANCCCGCCGGGGGCGCAGCGCCCGAGCCGCGGCCCTCGAGACGG
HKR279387 ARiS198H19 pGCAP10 NM_007364.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl